patrickfutrell9820 patrickfutrell9820

12-01-2024
Mathematics

contestada

What is the magnitude of this correlation? Make an educated guess based on the direction of the slope, and the distribution of the data points
A. 0.1
B. 0.5
C. 0.7
D. 0.9

Respuesta :

Otras preguntas

Zhang, who is z years old, is 5 years younger than Robert. The sum of their ages is 39. What are their ages?Write an equation. Solve.

A team of geologists learned from GPS data that two continents that have an ocean between them are moving towards each other. Diego's little brother hears this

HELP ME OUT PLEASE! The characteristics listed in the table describe which of the following? Patriot Loyalist Federalist Anti-Federalist

I NEED HELP FASTTTTT

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

If the following quadrilateral was rotated 180º about the origin, what would be the coordinates of each vertex of the resulting image? Pleasee helpp ill give br

David biked a trail on a mountain. The highest the trail went was 5 meters above sea level. The lowest the trail went was 34 meters below sea level. What is the

3x + 2y = 1 5x – 2y = 39

Explain in your own words why it is sufficient to find the x-intercept and y- intercept to graph a line.

Cate and Elena vlere playing a card game. The stack of cards in the middle had 26 cards in it to begin with. Cate added 6 cards to the stack. Elena then took 6