akheel7335 akheel7335

15-03-2024
Medicine

contestada

The energy in foods is expressed as:
a.a kilocalorie.
b.a calorie.
c.fat calorie.
d.carbohydrate calories

Respuesta :

Otras preguntas

Find the sum of 2x 2 + 3x - 4, 8 - 3x, and -5x 2 + 2. -3x2 - 2 -7x2 - 2 -3x2 + 6

Two sides of a right triangle have lengths of 2 centimeters and 7 centimeters. The third side is NOT the hypotenuse. How long is the third side?

What is one example where specialization may be a problem for a country?

Alpha Particles Beta Particles Gamma Radiation Put these different types of radiation in order from HEAVIEST to LIGHTEST.

Some people still supported spontaneous generation but thought that air was a ____ force

From Nicci's story, why do you think Nicci's friends were reluctant to speak up or take any action on the night of the movie?

please find the slope! thanks

List these electron subshells in order of increasing energy. 6p , 7s , 6s , 4f note for advanced students: you may assume these subshells are all in an atom wit

The length of a rectangle is 7 cm less than twice its width. if the area of the rectangle is 39 cm2, find the dimensions of the rectangle.

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds