meowwwww9 meowwwww9

11-12-2018
Mathematics

contestada

what number is 73% of 215

Respuesta :

shiestyshiester shiestyshiester

11-12-2018

Answer:

156.95

Step-by-step explanation:

google

Answer Link

kaitlynradel kaitlynradel

11-12-2018

Answer: 73% of 215 is 156.95

Step-by-step explanation:

all you have to do is multiply the number by the decimal measure of the percentage.

215 x .73 = 156.95

Answer Link

Otras preguntas

4 1/4 divided by 1 1/2

What is the measure of X

Find all the the real square roots of 144

What is the value of k? A. k = 28 B. k = 29 C. k = 31 D. k = 42

Read the resolution adopted by the United Nations General Assembly in 1960. The subjection of peoples to alien subjugation, domination and exploitation consti

Help me with this please !!!

Four cones of Dan's ice cream hold 5/8 pound. How much does each cone hold?

What is the typical no-load speed of a high-speed drill. A. 3,000 rpm B. 1,000 rpm C. 2,500 rpm D. 3,500 rpm

Which of the following best describes the flow of energy in the Everglades food web shown below? Diagram for an everglades food web. The food web contains the f

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds