yman39 yman39
  • 13-02-2019
  • Mathematics
contestada

Solve the equations. 7.2 = 4z + 3 - 3z

Respuesta :

zurfluhe
zurfluhe zurfluhe
  • 13-02-2019

Answer:

The answer is 4.2

Step-by-step explanation:

Subtract the 3 from both sides, leaving 4.2 from 7.2

Then, combine like terms to make 4z-3z=z

z=4.2

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
great Britain is an example of a core nation True or False
4 (2x-6)=10x-6. solve for x
Which type of oscillation would most likely produce an electromagnetic wave?
Two sides of a triangle have the following measure of 7,8.what is the range of possiable values for the 3rd side?
Determine the number of real solutions each quadratic equation has. y = 12x2 - 9x + 4 __ real solution(s) 10x + y = -x2 + 2 __ real solution(s) 4y - 7 = 5x2 -
Which section of an article would you look at to find out if assessors were blinded to treatment assignment?
You should always wear your seatbelt just in case the car comes to an abrupt stop. The seatbelt will hold you in place so that your body does not continue movin
What are the different ways of interpreting the title of the short story was it a dream
Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela