dantheban8793 dantheban8793

01-06-2019
Biology

contestada

Animals that regulate their body temperature by producing heat with metabolic reactions are called __________.

Respuesta :

01-06-2019

The answer is endotherms.

Answer Link

Otras preguntas

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

How does the spread of an airborne pathogen compare to the spread of foodborne and person to person pathogens?

You want to buy a tent in the shape of a pyramid. The rectangular base is 35 square feet, with a height of 4 feet. What is the volume of the tent? Round your an

hey I really need help its a test -3x=48 5x-1=29 4(x-6)+7=23 3(x-4)+5x=4

Compare the Raven in Poe’s Poem to raven in Native American poem

Please help! Of the skulls below, which one shows the most evidence of upright walking? Human Evolution A. Skull A B. Skull B C. Skull C D. Skull D

Public opinion is most value when the people who hold an opinion

Which one of the following men was NOT a member of Washington's first Cabinet? Thomas Jefferson Alexander Hamilton Henry Knox John Adams

What is the value of m in the equation 1/2m-3/4m=16, when n = 8

What is the difference between the words “escaped” and “escaping?” They are in different tenses. They are in different voices. They are different parts of spe