drizzyizzydem816 drizzyizzydem816

15-11-2019
Physics

contestada

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Respuesta :

15-11-2019

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

Answer Link

Otras preguntas

Ivan saves 20%of his monthley paycheck for music equipment he earned $wet last month. how much money did Ivan save for music equipment

After knee surgery, your trainer tells you to return to your jogging program slowly. He suggests jogging for 12 minutes each day for the first week. Each week t

One of the most common mutagens in our environment, that we are exposed to everyday we are outside in the sunlight, is

The distance between sandville and Lewiston is shown on the map what is the actual distance between the towns

What is the remainder of 712 divided by 28?

What is Swift’s purpose in listing other ways to solve the issue of poverty? A. to show that his plan to sell children is the most reasonable plan that has been

Which picture illustrates the anaphase stage of mitosis? A) picture A, where the spindle fibers start to pull away from the center of the cell. B) picture B, w

how do you put y=x+5 in a linear function?

URGENT!!!!***** An atom bonds with another atom. What is the best classification for this reaction? endothermic chemical nuclear redox

A term that means a change in velocity