jameshong919191 jameshong919191
  • 02-02-2020
  • Biology
contestada

10000 points
Which elements make up the empty space in the universe? Select two options.

ice
debris
dark matter
dark energy
gas and dust

Respuesta :

sfossum sfossum
  • 25-02-2020

Answer:

dark matter

dark energy

Explanation: JUST TOOK THE TEST

Answer Link
kloeyoung kloeyoung
  • 29-04-2020

Answer:

Which elements make up the empty space in the universe?  Select two options.

dark matter

dark energy

Answer Link

Otras preguntas

In two to four complete and grammatical sentences, please explain how the environmental ethics philosophy known as "holism" (ecocentrism) is different from the
Please I need help. Do not know how to do it
can someone pleaseee help me with this math question
1. Which are the purposes of government? 1.Limited Government 2.Provide for Common Defense 3.Protect rights 4.Provide Public Services 5.Popular Sovereignty 6.Eq
Which of the following contributes to the author’s development of an informal tone of Selection 1 instead of the formal tone of Selection 2?
answer 5a please :)
what is the theme of “cave of the cyclops
Question 4(Multiple Choice Worth 5 points) (Pythagorean Theorem LC) Can a triangle be formed with side lengths 3, 9, 17? Explain. O No, because 3+9 <17 O Yes
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Empirical Rule 06 IQ scores can be described using a Normal distribution with a mean of 100 and a standard deviation of 15. Using the Empirical '68-95-99.7' Rul