rtcumby rtcumby
  • 14-04-2020
  • Chemistry
contestada

What is the answer abcd ?

Respuesta :

awhite8798
awhite8798 awhite8798
  • 27-04-2020

Answer:

efghijklmnopqrstuvwxyz

Explanation:

thats the alphabet

Answer Link

Otras preguntas

Giovanni spent a total of $13.75 bowling. he rented bowling shoes for $ 2.50 and bowled 3 games. Each game cost the same amount.
in reciprocal is the denominator one unit
Why is the idea of playing a role or acting a part so important to Hamlet over the course of the play?
Which of the following describes the role of phloem in a vascular plant? A.A two-way flow of water and carbohydrates from chloroplasts B.A one-way flow of pro
Which of the following is a possible results of obesity? A) low blood pressure B) bone loss C)hight blood pressure D) common cold
what is 7/3/15 and what is 11/1/6
0 points which of the following was one of the policy changes thomas jefferson made when he became president? a. he used expensive displays to inspire the publ
Can someone please help me!
Can someone please help me!
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3