hernandezramidg0702 hernandezramidg0702

14-04-2020
Mathematics

contestada

8 = y + 3

Solve for the variable.

Respuesta :

chanceperdue2005 chanceperdue2005

14-04-2020

Answer: y = 5

Step-by-step explanation:

Answer Link

Otras preguntas

Attorney general a. mitchell palmer believed that he needed to protect the american people from

A man has blood type AB and his wife has blood type B. What are the possible blood types for their child

If o- can give to every other blood type, why cant it recieve other blood types

Why is the answer for #6 A?

The group that receives the treatment or test stimulus or factor under study is called the

For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s

What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36

Every month Tristan deposits $488 into an interest-bearing account to save for a down payment on a house. The interest rate on the account is 5.27% compounding

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Find f(x) if it is known that f(x−2)=2x−4.