keithbass06 keithbass06

16-05-2020
Mathematics

contestada

What is 8,080 divided by 37 as a decimal? A) 218.378 B) 218.378 C) 218.378 D) 218.3783

Respuesta :

vemkuki vemkuki

16-05-2020

Answer:

218.378 is the answer.

Answer Link

brustromeo brustromeo

16-05-2020

Answer:

D

Step-by-step explanation:

Because it is repeating decimal.

Hope this helps.

Answer Link

Otras preguntas

Which of the following equations is equivalent to 6.87p + 9.2 = -7.056?

Below is a table for f(x) = 3x + 1. Using the table, determine the value of x when f(x) = 13

hafizah harvested 49 mangoes from her farm. The weights of the mangoes, w in grams, are shown on the following frequency table

QUICK DUE SOON Which is greater? 90% of 60 170% of 30 Or are they equal

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

this is urgent due today Write a comparison and contrast essay in which you compare and contrast the character of Beowulf with that of a modern hero in a telev

Solve for a. 4(a + 3)=12 + 4a all real numbers −3 no solution −1

This is my account in the PHILIPPINES

penyaluran energi listrik terjadi melalui

A gardener is buildng a wooden border around a rectangular flower garden. The garden is 2 feet wide by 5 feet long. What is the least amount of wood needed to