spicymamita07 spicymamita07

12-09-2020
Mathematics

contestada

(6.42)-(-3.2) Btw I need to show my work...

Respuesta :

kgirl633 kgirl633

12-09-2020

Answer:

9.62

Step-by-step explanation:

Simplify the expression.

(6.42)+(-3.2)= 9.62

Answer Link

Otras preguntas

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Find the value of the unknown angles in each figure.HELPPP

a square with sides equal to 6 has the same area as a triangle with a base of 9. What is the height of the triangle?

The Miller family likes to petal along the north River. 1. They paddled the same distance each day throughout the course of three days, traveling a total of 14

1. How does income get from business to Consumers?

Find 8 1/3% of 72.

Why did Nationalism lead one country to join World War I?

synonyme d'adjectif vil

a chord is 4cm from the centre of a circle of radius 7cm . calculate the angle subtended by the chord at the centre

A pentagonal (five-sided) traffic sign is a sign. A. school crossing B. parking C. WRONG WAY D. YIELD