mnjbellino mnjbellino

15-09-2020
Mathematics

contestada

Is 19/2 rational number

Respuesta :

Аноним Аноним

15-09-2020

Yes, it is.

19/2 is a rational number, I’m fairly sure

Answer Link

Otras preguntas

Toxic waste can enter foods through the contamination of groundwater. true or false?

According to Newton’s Third Law, action and reaction are A equal and in the same direction B equal and in opposite directions C unequal and in the same directio

What can be used in the United States to stop a bill from being passed

Which civilization was eventually destroyed after the Spanish leader Hernán Cortés arrived? A. Maya B. Aztec C. Inca D. all three

Mark each statement that correctly describes the political and religious conflicts between the Ottoman and Safavid empires. A. The two empires experienced litt

Adidas is planning a research paper on media literacy. His teacher likes his ideas, but says that Adias needs to narrow the focus of his thesis statement. Which

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

How did Diane Arbus break down the barrier between the viewer and the subject in her photographs?

At least 20 to 30 minutes of sunlight exposure 3 times per week should provide enough vitamin user: which key nutrient has been known to reduce the risk of hear

.One location of The Smart Growing Preschool has 22 children in the primary class and 18 children in the toddler class. The other location has 30 children in th