Ellebatawila2031 Ellebatawila2031

12-11-2020
Mathematics

contestada

What 10 x 13x 5 x6 x8 x9 x9 x0

Respuesta :

am6261410 am6261410

12-11-2020

Answer:

0

Step-by-step explanation:

If those x's are NOT variables, then the answer is 0. The x is a multiplication sign, right?

Answer Link

Otras preguntas

Simplify: 8p^4+6q^4.

in the eighteenth century, british colonists wishing to settle west of the appalachians were principally motivated by

How did the 7 year was negatively affect the colonies?

Find BC if B(8,-7) and C1-4,-2).

Find f(-2) if f(x)= x^4 + 2x^2-1 Answer:?

Mrs. Rockwell lost money on an investment at a rate of $4 per day. What is the change in her investment, due to the lost money, after 4 weeks?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

What is the difference between the product of 456 and 18 and the product of 312 and 14

pls help i need this done asap.

John is making an experiment for class. The equation H=-0.3m+16.4 models the relationship between the height of a candle in centimeters. H is the time the candl