4804276434 4804276434

03-02-2021
Mathematics

contestada

A migrating bird flies 390 miles in 15 hours. How many miles does it fly in 4 hours?

Respuesta :

fun54658 fun54658

03-02-2021

Answer:

104

Step-by-step explanation:

390/15=26

26 times 4 is 104

Answer Link

Otras preguntas

Mixing lime green and scarlet red would result in what outcome?

True/false Sometimes extinction can have a very large impact on an ecosystem. Such important species are called keystone species. True/false Sometimes species a

What type of recording option begins the recording automatically when the decibel level of the input sound goes above a preset level? A. auto input B. auto re

What was the domestic reform agenda of Kennedy’s New Frontier, and how did Johnson’s Great Society programs continue and expand on that agenda?

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

Just because two people weigh the same does not mean they have the same ________ proportions.

Which of the following does not take place in the game of economics? A. Distribution B. Production C. Evaluation D. Consumption

TV emporium had a huge sale in the morning 5/12 of the flat screens were sold in the afternoon 1/3 of the flat screens were sold how many TV's were sold altoget

create a word problem for 2x+10=30

You just ate a bowl of mashed potatoes. The starch began chemical digestion in your mouth and finished in your duodenum with hydrolysis into glucose molecules.