video4all video4all
  • 04-03-2021
  • Biology
contestada

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Respuesta :

addysenseheult addysenseheult
  • 04-03-2021

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Answer Link

Otras preguntas

What logically could have gone wrong?
Which stage of the writing process is considered the writer centered Phase
Benefits of regular exercise outweigh the risk of injury. a. True b. False
What is the kingdom of god according to the gospels?
Plants that are small, rely on water for reproduction, and lack true roots, stems and leaves are
How many covalent bonds are there in one molecule of carbon dioxide, CO2?
built one of the greatest cities of the ancient world and named it after himself herodutos Lighthouse of Alexandria Zeus Alexander the Great Euripides Demosthen
How does Hardin’s lifeboat metaphor create a zero-sum situation
Felicia poked herself while disposing of a needle that she had just used to administer medication to a patient. She was later tested for infection from this nee
What number is 0.75% of 56?.