Davina18
Davina18 Davina18
  • 14-11-2016
  • Mathematics
contestada

Which ratios are equivalent to 3:4

Respuesta :

Аноним Аноним
  • 14-11-2016
9:12, 18:24,6:8

3*3=9 and 4*3=12

3*6=18 and 4*6=24

3*2=6 and 4*2=8
Answer Link
Аноним Аноним
  • 14-11-2016
6:8
9:12
12:16
15:20
18:22
Its just multiplying. :)


















































Answer Link

Otras preguntas

What do Larry Page and Jessica Jackley have in common? (1 point) Group of answer choices They are Internet entrepreneurs. They cofounded MySpace. They help deve
what is organelle function/characteristics?
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
D. Fill in the blank space with the correct alternative from the brackets.1. He is .......... late for school. (usual, usually)2. He goes to India ....... (twic
NEED HELP.......... ....... ​
Which graph below represents a functional relationship? A. 10 10 8 8 6 6 4 2 2 X 10864 6 8 10 10 8 6 4 4 6 8 10 -21 4 -61 -8 -8 10. -10 B. OD. 107 101 8 8 6 6 1
The Song dynasty is accredited with improving the government employment by creating _________.
The Spanish Colonel __________ led the military campaign against the Wichita Twin Villages. A. Francisco Coronado B. Juan de Oñate C. Juan de Padilla D. Diego O
A man earns rs 24000 per month and spends 70% of it find his monthly saving​
Solve by substitution. 5x + 4y = -14 y = -7x - 15