sabarishkumar72 sabarishkumar72

02-05-2021
Mathematics

contestada

1. A coin is tossed once, what is the probability of getting a head

Respuesta :

DdechenLhazin DdechenLhazin

02-05-2021

Answer:

The answer is...1/2

Step-by-step explanation:

1- head

1-tail

To get head-1/2

Answer Link

oceanmonkey24 oceanmonkey24

02-05-2021

Answer:

the answer is 1/2

Step-by-step explanation:

you have 2 sides each side a 50% chance

Answer Link

Otras preguntas

Use flunky in a sentence in your own words!

help with this asap!

answer both for ( brain list, thanks, 5 star review)

answer this correctly and i will give brainliest

Prove that ----1/2 (cos :2 theta-cos 8theta)=sin 5theta.sin 3theta

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

length of 8 in, width of 4 in, height of 2 1/4 in, How many cubes are needed to fill the rectangular prism?

Help pls this is the third time I asked for help pls someone!!!

Sur une photographie réalisée avec unmicroscope, une fourmi mesure 6 cm.Sachant que 20 mm sur la photographie représentent1 mm dans la réalité.Quelle est la ta

I need help on this