8016586 8016586
  • 15-06-2021
  • Biology
contestada

how does a self feeder get food

Respuesta :

janssonparker345
janssonparker345 janssonparker345
  • 15-06-2021

Answer:

Autotrophs (self-feeders) are organisms that use an external energy source to assimilate inorganic resources from the environment and synthesize the biological molecules needed to sustain life. The ultimate source of this energy is the nuclear fusion of hydrogen in the Sun.

Explanation:

Answer Link

Otras preguntas

Find the y-intercept of the graph shown. Pls show work!
T=s+.50 T=0.25s+1.70 In the equation above t and a represent the weight in tons of a sedan and of a truck, respectively. What is the weight of a sedan in tons
Do 3/5 and 9/15 equal the same Whole?
Which catalyzed reaction breaks up ozone? 2H2O2(l) right arrow with upper M n upper O subscript 2 above it. 2H2O(l) + O2 O3 + O Right arrow with upper C upper S
would you have considered settling on the Texas frontier during this era ? why or why not​
Okolona College ordered jerseys to sell at the homecoming game. The college paid $9.25 each for 225 jerseys. Each jersey was sold for $15.75. what was the perce
Sophie is an accomplished plastic surgeon who has lost her medical license due to her addiction to illegal drugs. Vanessa hires Sophie for a "filler party" in w
how do i solve using the substitution method? x+y=-1 y=-2x
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
An angle measures 26° less than the measure of its complementary angle. What is the measure of each angle? Explain