sidneydominguez7561 sidneydominguez7561

01-08-2022
Physics

contestada

The half-life of carbon 14 is 5730 years. If a 1-gram sample of old carbon is 1/8 as radioactive as 1-gram of a current sample, then the age of the old sample is about?

Respuesta :

01-08-2022

Answer:

The age of the sample will decrease by 1/2 for each half-life that the sample undergoes:

1/2 * 1/2 * 1/2 = 1/8

The data indicates that the sample has undergone 3 half-lives of decay

3 * 5730 = 17190 yrs is the approximate age of the sample

Answer Link

Otras preguntas

Heyy Answer please and explain

1. What was the Chinese Exclusion Act of 1882? Why was this act adopted?

A sector is a diversified group of companies. True or False

Which is the best example of American citizens defending our nation from threats to national security?

The relationship is:for every minute, 22 jumping jacks are completed.Create a graph to show your relationship. Make sure you include all the parts for a graph a

What typically happens during a story's falling action? A. Characters set out on a quest or journey. B. Necessary background information is provided. C. The mos

state the physical properties of non- metals?

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Which of the following conditions is least likely to have an effect on natural selection in a species of sheep that are geographically isolated on an island? A.

Introduction to single