jully2166 jully2166
  • 01-08-2022
  • Health
contestada

What are implications for massage for a client taking anti-infective medications?

Respuesta :

hailiecrumpton759
hailiecrumpton759 hailiecrumpton759
  • 02-08-2022

Answer: The main concerns with giving a massage while a person has an infection are that we don’t want to spread that infection more, especially if the infection is more acute–and if their medications haven’t had time to really take effect, then that could be a contraindication for giving a massage.

Explanation:

Answer Link

Otras preguntas

A roll of quarters is 10$ how many q in a roll write a equation
Last season Steven missed 24% of the free throws in his basketball games. In the two first games this season he got to shoot 25 free throws. If his missed free
Assessment started: undefined. Item 1 Select a word from the drop-down menu to correctly complete the statement. The elements fluorine, chlorine, and iodine are
What insect forages for leaves to fertilize the fungus that it grows for food? A.Bark beetles C. Praying Mantis b. Ladybirds d. Leaf-cutting ants
a baseball flying through the air has_?​
Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t
Express this number in scientific notation. 0.0013?
what happend to some native Americans during Jackson presidency
Rihanna can go from 0-60 miles per hour in 3.5 seconds. Calculate the acceleration. Please show ALL work and CIRCLE your answer.
Which graph represents the function f(x) = –|x| – 2?