lewisstructure lewisstructure
  • 01-03-2017
  • Chemistry
contestada

Lewis structure for CO2

Respuesta :

Аноним Аноним
  • 01-03-2017
O = C = O Straight because there is no solitary electrons on C
Answer Link
lucasmehringer
lucasmehringer lucasmehringer
  • 01-03-2017
this picture shows you the dot structure of CO2
Ver imagen lucasmehringer
Answer Link

Otras preguntas

What would you do in these situations? example: If I could be anyone famous... "I would be the president of the country." 1. If I found 100 euros in the street
What does Klemperer suggest about how most Germans felt about Hitler in 1938
Humans can become conditiined to pair certain food flavors with certain events .
What causes this extreme weather tornados?
Label the terms in the expression as constant, linear, and quadratic. 4x2 + 3x - 6
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
What percent of discount should Store A have if the cost to store is $162 and the markup is 40%?PLEASE ANSWER AS SOON AS POSSIBLE!!!!!!
Health Services employees who work in university research centers most likely work for
Where a linear equation crosses the y-axis, that point is called the
To produce a tint of the color green you should add