trevarr
trevarr trevarr
  • 05-05-2017
  • Mathematics
contestada

100 acres to 140 acres

Respuesta :

HammyTheKid
HammyTheKid HammyTheKid
  • 05-05-2017
the ratio is 5:7 acres


the non-simplified ratio is 100:140
you can divide both sides by 20
100/20= 5
140/20 = 7
Answer Link

Otras preguntas

An airline’s weekly flight data showed a 98% probability of being on time. If this airline has 15,000 flights in a year, how many flights would you predict to a
behaving in an acceptance manner within a workplace environment is refered to as a workplace etiquette. true or false
Access to valuable ______ may be playing a role in papua new guinea's struggle against islands that want to secede from that nation.
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Can you give me a short summary (only in 1 or 2 sentences) on Shakespeare’s Macbeth. And what it is.
show work and factor ?
What is the main reason night driving is more difficult than daytime driving?
Thinking about suicide is called _________, and a suicide attempt that is not completed is called __________.
What role does the House of Representative have in the impeachment process?
Please help ASAP!!!! 100 points!