LanaParrilla
LanaParrilla LanaParrilla
  • 01-11-2017
  • Mathematics
contestada

What is the length of RS

What is the length of RS class=

Respuesta :

JDMarkS1425
JDMarkS1425 JDMarkS1425
  • 01-11-2017
It is 32. It matches with side LM and so it's equal to 32
Answer Link
choixongdong
choixongdong choixongdong
  • 01-11-2017
RS = LM = 32

hope it helps
Answer Link

Otras preguntas

1. What was the Chinese Exclusion Act of 1882? Why was this act adopted? ​
Find the surface area of the net. Each square is one square meter. Help please!!
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein
What is the formula for calculating tension​
Latasha explores some passages in a cave. The elevations of the passages are all above - 10 meters. Let y be the elevation of a passage in meters. Write an ineq
How many layers are in a gram positive cell wall and how many are in a gram negative cell wall ?
I hope for a solution
If you are at a shop and you are telling the shopkeeper that you need something, how do you say " need"? Type in your response: Question 8 4 pts Image courtesy
Why was Pope Gregory called “the Great"?
Before creating an artist's statement about a piece of clothing you created, which would you have to do first? A)Show your project to as many people as possible