msauce5982 msauce5982

13-11-2017
Chemistry

contestada

Which element has an atom in the ground state with a total of 5 valence electrons?

Respuesta :

jaydenolivia3 jaydenolivia3

17-11-2017

All of the elements in group 5 have 5 valence electrons.

Answer Link

Otras preguntas

_______ is a strategy of summarizing by focusing only on the main points of a text or a lecture

Write one sentence for each type of comparison that demonstrates the following types of figurative language. a. Metaphor b. Simile c. Idiom

Are women's feet getting bigger? retailers in the last 20 years have had to increase their stock of larger sizes. wal-mart stores, inc., and payless shoesource,

Joseph is baking a cake and measures out 3 cups of sugar. When he re-reads the recipe, he realizes he only needs 2 cups. The fraction 2/3 represents the ratio

A double-stranded dna molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. top: tacatgatcatttcacggaatttctagcatg

What pH value can be assigned to acids and bases, respectively?

If cos x= 5/13 and sin x <0 find cos (x/2) and sin (2x)

What is the value of x? Enter your answer in the box. x =

Helicobacter pylori is a bacterium found in the stomachs of roughly half of the human population. it is considered to be a pathogen because __________.

Two points on the same side of the tree are 65 feet apart. The angles of elevation to the top of a 10.5 foot tree are 21˚19’ from one point and 16˚20’ from the