Kahla1
Kahla1 Kahla1
  • 14-04-2018
  • Social Studies
contestada

Please HELP ME!!!!!

Please HELP ME class=

Respuesta :

trenacompton40p6xjjh trenacompton40p6xjjh
  • 14-04-2018
C because he becomes the leader he can rescue the boys
Answer Link
annabel10
annabel10 annabel10
  • 14-04-2018
The answer is C as he rescues the boys
Answer Link

Otras preguntas

Nick bought a music player. The price was $172, and the sales tax rate was 7 percent. How much sales tax did Nick pay when he bought the music player?
How to find the height of a triangle when only given an angle and a side length.
the following system of equations can be used to find the roots of the equation x^3+72=5x^2+18x
Which is not a categories of development in a lifespan? physical, informational mental, emotional
What did the supreme court order us schools to do in 1954 answers?
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
Write the equation of the line which passes through (3,7) and (-5,-1). Write the answer in slope-intercept form
The interval between the commission of the crime and its discovery is called ___________.
Steven earns extra money babysitting. He charges $31.00 for 4 hours and $54.25 for 7 hours. Enter an equation to represent the relationship. Let x represent the
Use logarithms to solve each equation 2x9/8=111