ishworadp86ib5 ishworadp86ib5

04-05-2018
Physics

contestada

why bucket of water is filled faster in downstairs tap than in the upstairs tap

Respuesta :

therealwillpaez therealwillpaez

04-05-2018

i think that the downstairs would be faster because the water wouldn't have to go all the way up which make it slower

Answer Link

Otras preguntas

Adele earns about $15 each day in tips as a waitress. If she saves $7.50 of it, how many workings days will ot take her to save $225 ?

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3

Which event in the typical life cycle of sexually reproducing fungi involves transition from a haploid to a diploid stage?

A penny fell off the top of the building and hit the sidewalk below 3.1 seconds later how many meters did the penny fall to the sidewalk

what is x? using the picture below and directions

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

How do you determine the type of ion charge any element will form based on its number of valence electrons?

Which of the following have at least two congruent parallel bases? all that apply. A. Cylinder B. Circle C. Cone D. Cube E. None of these F. Pyramid

Molly is buying a house for $202,000. she is financing $185,500 and obtained a 30 year fixed rate mortgage with a 5.125% interest rate. How much are her month

Which is a characteristic of cancer cells? predictable, uniform cell division evidence of cellular cohesiveness uniform size and shape poor differentiation?