joey060805 joey060805

01-05-2020
Mathematics

contestada

(x+5)(x+3) Polynomial in standard form

Respuesta :

01-05-2020

Answer:

Roots of the equation (x+3)(x+5)=0:

−3, multiplicity 1.

−5, multiplicity 1.

Step-by-step explanation:

Answer Link

Otras preguntas

Describe the ways Hitler stereotypes the Jewish community.

Can someone plz help me!!!!!

Store reduces an item 20% after 3 weeks if unsold a further 30% if unsold after 6 weeks and after 7 weeks a further 10% estimate the price after 8 weeks price o

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Can Someone Please Help!!!!

A mobile home company delivered 27,499 homes in 2008. This number represents 1/3 of the industry total. Based on these numbers, how many mobile homes did the in

Which of the following chemical substances has a triple covalent bond? A. carbon dioxide (CO2) B. oxygen (0) C. carbon monoxide (CO) D. water (H,0)

90% of people inside the grocery store were wearing their face masks properly. 54 people were wearing their masks properly. How many people were in the grocery

four qualities required to healthy relationship?

what is the monthly cost