MayaOhmaya MayaOhmaya

03-11-2016
English

contestada

Wat does dependency reversal

Respuesta :

oliviac1 oliviac1

03-11-2016

It refers to possessive-like attributive constructions (of the type (that) idiot of a doctor), with the attribute surfacing as the formal head and the semantic head surfacing as the formal possessor.

Answer Link

Otras preguntas

-5 + a/4 equals - 1 equals what?

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

The same baseball is thrown two different times The second throw is faster than the first throw.Which has more kinetic energy?

In four hours, a hiker in a canyon goes from 892 ft to 256 ft above the canyon floor. Find the hiker’s vertical speed. A. 287 ft/h B. –287 ft/h C. –159 f

A box contains 1000 balls, of which 2 are black and the rest white. a) Which of the following is more likely to happen in 1000 draws with replacement from the b

a classic creation story tells how the world was made or humanity came into existence

The epic style includes? Formal diction and a serious tone Informal diction and a serious tone Formal diction and a sarcastic tone Informal diction and a comedi

Which of these four elements is the most reactive metal? Na,Rb,Al,In

1) -5g-6 for g=-2 A) 4 B)16 C)10 D)-13 2) Write an algebraic expression for the sum of 3 coins and c coins A) c+3 B)c/3 C)3c D)c-3 3) x-2=16 A)14 B)18 C)21 D)1

In triangle ABC, angle BC=4x+4 and angle AC= 6x-14 and angle BC=2x+7. What is BC