Anonymuz9313 Anonymuz9313
  • 04-08-2017
  • Biology
contestada

Another name for the evolutionary force called gene flow is:

Respuesta :

dacampora1
dacampora1 dacampora1
  • 04-08-2017
Another name for gene flow is admixture.
Answer Link

Otras preguntas

What is the next step in the construction of an angle bisector of angle ABC?
What is 2/3 divided by 4/5
In the context of team compensation and recognition, _____ encourage employees to acquire the abilities that they will need to perform multiple jobs within a te
why is intra-b not part of e-commerce​
A marine biologist dredges up a small animal from the bottom of the ocean. It is uniformly segmented, with short, stiff appendages and soft, flexible skin. It h
determine which set of numbers can be the measeures of the sides of a triangle A) 2, 6, 3 B) 3, 10, 13 C) 4, 6, 1 D) 5.1, 7, 2.3
Write a function rule for the table. Hours Worked Pay 2 $11.50 4 $23.00 6 $34.50 8 $46.00
In two or more complete sentences, explain the law of conservation of mass
-7x-27=8-1(x-19) what’s the answer
I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC